Molecular Dynamics Study of the Inhibition of Monomeric HIV-1 Protease
as Alternative to Overcome Drug Resistance by RNA Aptamers
Abstract
Here the interaction of three aptamers with HIV-1 protease has been
investigated with the help of molecular dynamics simulations. These
simulations lead to precise structural and energetic results. The
sequencing of the considered aptamers is AP1 as the aptamer number 1:
(CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU), AP2 as the aptamer
number 2: (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) and AP3
as the aptamer number 3: (C, U, A, C, and C nucleotides of AP1 were
replaced with A, G, G, A, and C to yield AP3). The results of molecular
dynamics simulations show that aptamers 2 and 3 are good alternatives to
interact with the protease enzyme and to control this enzyme, but in AP2
has somewhat improved the results. The results of MM-PBSA show that
although aptamer three as a mutant aptamer has a good affinity with the
protease enzyme compared to aptamer one and by impairing dimerization,
it disrupts its structural stability and function. However, the results
indicate that aptamer 2 is a better inhibitor because it causes a more
severe conformational change in the structure of the enzyme.