Animals
All procedures on living mice were carried out in compliance with the Imperial College Statement for Use of Animals in Research, under a UK Home Office project license. All animal care and experimental protocols adhered to (a) the US National Research Council’s Guide for the Care and Use of laboratory animals, (b) the ARVO guidelines and (c) the BJP guidelines for experiments involving animals and animal tissues. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010; McGrath and Lilley, 2015).
Prostaglandin E receptor 2 (EP2) knock-out mice (B6.129-Ptger2tm1Brey /J) were purchased from The Jackson Laboratory (Bar Harbour, Maine, USA), supplied via Charles River Ltd. UK. These mice were originally created in a C57BL/6J background via homologous recombination and exhibit increased sensitivity to dietary salt induced hypertension and produce small litter sizes due to a defect in embryo implantation (Kennedy et al. , 1999). We therefore adopted the following breeding strategy.Ptger2+/- breeding pairs were purchased from the Jackson Laboratories. Male Ptger2-/-offspring were then crossed with femalePtger2+/- offspring to producePtger2-/- individuals. Separately,Ptger+/+ offspring were crossed withPtger2+/- offspring to producePtger2+/+ individuals.Ptger2-/- andPtger2+/+ individuals were thus separated by 1 generation. For experiments that used only WT mice, C57BL/6J mice were purchased from The Jackson Laboratories and used without breeding. Mice were housed in individually ventilated cages with a 12-hour light/dark cycle, maintained at 21°C, with food and water ad libitum. Following arrival from the commercial supplier, mice were allowed to acclimatise for a week before any regulatory procedures were performed.
Genotyping followed the recommended protocol provided by the Jackson Laboratory for B6.129-Ptger2tm1Brey /J mice. Genotyping was carried out on DNA extracted from ear tissue sampled at weaning, following the manufacturer’s instructions (Express Extract, Kapa Biosystems, Cambridge, MA, USA). KAPA2G Robust HotStart ReadyMix (Kapa Biosystems) was used for PCR reactions. Knock-out sense primer (ATTAAGGGCCAGCTCATTCC), wild-type sense primer (TGCTCATGCTCTTCGCTATG) and common antisense primer (CGTACTCCCCGTAGTTGAGC), with annealing temperatures of 60°C and 28 cycles, yielded predicted products of 300 bp for knock-outs and 165 bp for wild-types (Supplemental Figure 1D). PCR products were resolved by gel electrophoresis (1% agarose) in the presence of a DNA gel stain (SYBR Safe, Invitrogen, Carlsbad,CA, USA). Bands were visualized on an imaging station (Biospectrum 500, UVP, Upland, CA, USA).