Animals
All procedures on living mice were carried out in compliance with the
Imperial College Statement for Use of Animals in Research, under a UK
Home Office project license. All animal care and experimental protocols
adhered to (a) the US National Research Council’s Guide for the Care and
Use of laboratory animals, (b) the ARVO guidelines and (c) the BJP
guidelines for experiments involving animals and animal tissues. Animal
studies are reported in compliance with the ARRIVE guidelines (Kilkenny
et al., 2010; McGrath and Lilley, 2015).
Prostaglandin E receptor 2 (EP2) knock-out mice
(B6.129-Ptger2tm1Brey /J) were purchased from
The Jackson Laboratory (Bar Harbour, Maine, USA), supplied via Charles
River Ltd. UK. These mice were originally created in a C57BL/6J
background via homologous recombination and exhibit increased
sensitivity to dietary salt induced hypertension and produce small
litter sizes due to a defect in embryo implantation (Kennedy et
al. , 1999). We therefore adopted the following breeding strategy.Ptger2+/- breeding pairs were purchased from
the Jackson Laboratories. Male Ptger2-/-offspring were then crossed with femalePtger2+/- offspring to producePtger2-/- individuals. Separately,Ptger+/+ offspring were crossed withPtger2+/- offspring to producePtger2+/+ individuals.Ptger2-/- andPtger2+/+ individuals were thus separated by 1
generation. For experiments that used only WT mice, C57BL/6J mice were
purchased from The Jackson Laboratories and used without breeding. Mice
were housed in individually ventilated cages with a 12-hour light/dark
cycle, maintained at 21°C, with food and water ad libitum. Following
arrival from the commercial supplier, mice were allowed to acclimatise
for a week before any regulatory procedures were performed.
Genotyping followed the recommended protocol provided by the Jackson
Laboratory for B6.129-Ptger2tm1Brey /J mice.
Genotyping was carried out on DNA extracted from ear tissue sampled at
weaning, following the manufacturer’s instructions (Express Extract,
Kapa Biosystems, Cambridge, MA, USA). KAPA2G Robust HotStart ReadyMix
(Kapa Biosystems) was used for PCR reactions. Knock-out sense primer
(ATTAAGGGCCAGCTCATTCC), wild-type sense primer (TGCTCATGCTCTTCGCTATG)
and common antisense primer (CGTACTCCCCGTAGTTGAGC), with annealing
temperatures of 60°C and 28 cycles, yielded predicted products of 300 bp
for knock-outs and 165 bp for wild-types (Supplemental Figure 1D). PCR
products were resolved by gel electrophoresis (1% agarose) in the
presence of a DNA gel stain (SYBR Safe, Invitrogen, Carlsbad,CA, USA).
Bands were visualized on an imaging station (Biospectrum 500, UVP,
Upland, CA, USA).