RNA extraction and RT-PCR
Primer sequences were synthesized by Generay Biotech and the total RNA was extracted from cells using RNAiso Plus kit (Takara, Japan). The mRNA levels of SLC5A1 , SLC5A2 , and Actin were detected by the quantitative real time PCR. The primer sequences of SGLT1 and SGLT2 are as follows: SLC5A1-F: GTCGGACTGTGGGCTATGTT, SLC5A1-R: GTCTGCAAGGTGTCCGTGTA; SLC5A2-F: ACGCCCATGTTTCTCATGGT, SLC5A2-R: CCTGGGGCTCATTCATCTCC.