2 Materials and methods
ShRNA clones were downloaded from sigma website or designed by Online
software.
2.1 Silence sequence : GTCCTGGTCTTGAACAAGATT
Sense and antisense strands were annealed to become shRNA. Vector
pGFP-B-RS was dissolved by HindⅢ and BamHⅠ at 37℃ for
2h~3h,and enzyme-digested vector was also run on 1.0%
agarose gel and refined by Qiagen column kit. A linearized vector DNA
digested by HindⅢ and BamHⅠ and drop-in shRNA were ligase by T4 DNA
Ligase (NEB). Plasmids were brought into Escherichia coli by chemical
transformation. Cells were put onto LB plates containing kanamycin. Then
plates were incubated overnight at 37℃. Colonies were screened by colony
PCR (30 cycles) with universal primers (located on the backbone vector).
The interference sequence of shRNA was checked by Sanger sequencing.
CDNA synthesis was done by standard procedures and RT-PCR was performed
on the Bio-Rad S1000 with Bestar SYBR Green RT-PCR Master Mix (DBI
Bioscience, Shanghai, China). The depth of sequencing information is 10G
per specimen.