2 Materials and methods
ShRNA clones were downloaded from sigma website or designed by Online software.
2.1 Silence sequence : GTCCTGGTCTTGAACAAGATT
Sense and antisense strands were annealed to become shRNA. Vector pGFP-B-RS was dissolved by HindⅢ and BamHⅠ at 37℃ for 2h~3h,and enzyme-digested vector was also run on 1.0% agarose gel and refined by Qiagen column kit. A linearized vector DNA digested by HindⅢ and BamHⅠ and drop-in shRNA were ligase by T4 DNA Ligase (NEB). Plasmids were brought into Escherichia coli by chemical transformation. Cells were put onto LB plates containing kanamycin. Then plates were incubated overnight at 37℃. Colonies were screened by colony PCR (30 cycles) with universal primers (located on the backbone vector). The interference sequence of shRNA was checked by Sanger sequencing. CDNA synthesis was done by standard procedures and RT-PCR was performed on the Bio-Rad S1000 with Bestar SYBR Green RT-PCR Master Mix (DBI Bioscience, Shanghai, China). The depth of sequencing information is 10G per specimen.