Determination of Zn 2+ concentrations on Zrt1
and Fet4 expression level in S. cerevisiae
EZ-10 Spin Column Fungal RNA Miniprep Kit (Bio Basic, Canada) was
applied according to the manufacturer’s structure, to isolate total RNA
from zinc absorbed yeasts. Then, cDNA was immediately prepared with the
AccuPower RocketScript RT PreMix (Bioneer, Korea). Subsequently,
relative quantification of Zrt1 and Fet4 expression was determined using
quantitative real time PCR (qRT-PCR) with RealQ Plus 2x Master Mix Green
(Ampliqon Co, Denmark). The qRT-PCR reactions were prepared in a total
volume of 20 µl and cycling conditions of 95°C (15 min), followed by
95°C (20 s, 40 cycles), and 60°C (1 min) was performed. We used same
designed primers of Zrt1 and Fet4 genes which had been used in yeasts
isolation step; also F: 5’ AAACGGCTACCACATCCAAG 3’ and R:
5’ CCCATCCCAAGGTTCAACTA 3’ pairs were applied for amplification of
18SrRNA gene as internal control. Finally, melting curve analysis was
considered to validate the specificity of the expected PCR product as
well as nonoccurrence of primer‐dimer formation. All reactions were
carried out in triplicate and the results were analyzed by threshold
cycle (Ct) values.