RNA preparation and RT-PCR
Total RNA from human kidney (ThermoFisher AM7976) was used together with total RNA from whole blood samples and urine-derived renal epithelial cells (hUREC) isolated using RNeasy mini kit (Qiagen) according to the manufacturer’s instructions and quantified using a NanoDrop 2000 spectrophotometer. 0.75µg RNA was reverse-transcribed using an oligo-dT primer and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). The resulting cDNA was used for PCR with a GoTaq® DNA Polymerase (Promega) and a CC2D2A gene- specific primer pairs (5- TGAGAGACACTGGCTGGGAT -3 and 5- AGGCACTGACGATTTGGAAAC -3) to identify basal skipping of exon 30. Primers were designed using NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi). Amplification of HPRT1 housekeeping gene cDNA was performed alongside. Product electrophoresis was performed on a 2% agarose gel.