agr, toxin and MSCRAMM characterization
Genomic DNA, used as a template for PCR amplification, was extracted
with QIAamp®DNA Mini Kit (Cat No. 51306, Qiagen)
following the manufacturer’s instructions, with some modifications.
Briefly, a bacterial suspension was centrifuged and the pellet was
resuspended in 200ul physiological saline solution 0.9% and subjected
to freezing and thawing twice. After centrifugation the bacteria pellet
was resuspended in 180µl of enzyme solution: 20 mg/mL lysozyme (cat No.
10837059001 Sigma-Aldrich-Merck KGaA, Darmstadt, Germany) and 100 μg/ml
lysostaphin (cat. No. L7386-15MG, Sigma-Aldrich-Merck KGaA) in TE buffer
pH 8.0 (cat.No. AM9849 Ambion, Invitrogen). After these changes, the
indications provided by the manufacturer were followed.
Toxin and MSCRAMM genes included in the study and listed in table S1
were tested as previously described (Stefani et al. , 2009). Theagr locus was typed using a multiplex PCR assay (Gilot et
al. , 2002). PCR for the cna gene was performed used the
following primers in 5’-3’: F- GGAAAACGACCAACTGAAATCAAAG, R-
TCTGGCGTATATTTATTCGTCACAATC. PCR was performed at 57°C, the product size
was 239bp, strain MW2 was used as internal control.
PCR amplification was carried out in a Veriti Thermal Cycler (Applied
Biosystems, ThermoFisher, Italy) in a total volume of 25µl containing 2×
Multiplex PCR Master Mix (cat. No. BR0200804, biotechrabbit GmbH,
Hennigsdorf, Germany), and 10ng template DNA.