2.2 DNA extraction, PCR, and NGS sequencing
K . schrenkianum plants were divided in to aerial parts and roots to analyze the endophytic microbes, and altogether 40 samples (5 individual × 4 treatments × 2 tissue types) were used for DNA extraction. Each plant material (20 g) was surface sterilized with 75% ethanol for 1 min, 3.25% sodium hypochlorite for 3 min, and 75% ethanol for 30 s (Guo, Hyde, & Liew, 2000). Genomic DNA was extracted following CTAB method (Guo et al., 2000). One gram of the surface-sterilized plant material was freeze-dried using liquid nitrogen, homogenized with a mortar and pestle, transferred to a tube with 5 mL 2× cetyltrimethylammonium bromide (CTAB) extraction buffer (2% (w/v) CTAB, 100 mM Tris-HCl, 1.4 M NaCl, 20 mM EDTA, 1.5% polyvinyl-pyrolidone (PVP), 0.5% 2-mercaptoethanol; pH 8.0; preheated to 65 °C). The concentration of DNA was measured using a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Wilmington, USA).
The V5-V7 hypervariable region of the bacterial 16S ribosomal RNA gene was amplified using 799F (AACMGGATTAGATACCCKG) (Chelius & Triplett, 2001) and 1193R (ACGTCATCCCCACCTTCC) primers (Bodenhausen, Horton, & Bergelson, 2013). The fungal internal transcribed spacer region 1 (ITS1 region) of ribosomal RNA was amplified using ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes & Bruns, 1993) and ITS2 (GCTGCGTTCTTCATCGATGC) primers (White, Bruns, Lee, & Taylor, 1990). All PCR reactions were carried out in 30 µL reactions with 15 µL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA); 0.2 µM of forward and reverse primers, and about 10 ng template DNA. Thermal cycling consisted of initial denaturation at 98℃ for 1 min, 30 cycles of denaturation at 98℃ for 10 s, annealing at 50℃ for 30 s, and elongation at 72℃ for 30 s, followed by a final extension at 72℃ for 5 min. Mix same volume of 1× loading buffer (contained SYB green) with PCR products and operate electrophoresis on 2% agarose gel for detection. Then, PCR products was purified with GeneJETTM Gel Extraction Kit (Thermo Scientific, Waltham, MA). Sequencing libraries were generated using Ion Plus Fragment Library Kit 48 rxns (Thermo Scientific, Waltham, MA) following manufacturer’s recommendations. The library quality was assessed on the Qubit@ 2.0 Fluorometer (Thermo Scientific, Waltham, MA). At last, the library was sequenced on an Ion S5TM XL platform.