2.2. RNA Isolation and Quantitative Real Time-PCR
Total RNA was extracted from whole larvae using RNeasy Plus Mini Kit (Qiagen, Toronto, ON, Canada). One microgram of total RNA input was reverse transcribed to cDNA using the iScript Reverse Transcription Supermix (Bio-Rad Laboratories, Mississauga, ON, Canada). The cDNA equivalent of 15ng total RNA was analyzed in triplicate by RT-qPCR using the SsoAdvanced SybrGreen PCR mix (Bio-Rad) and the MACHINE Biorad. The raw data were exported from the CFX Manager™ Software (Bio-Rad, Canada), and the relative gene expression was calculated using the Relative Expression Software Tool (REST-2009)[43]. The 18srRNA gene served as the reference gene to verify changes in the expression of the target gene tyrosine hydroxylase (TH; which is the marker enzyme for dopaminergic neurons). The qPCR primers for TH were: forward, 5’- TTGTGTCCGAGAGCTTTGAG-3‘ and reverse, 5‘- AAGCATTCTGGATCTTGGAGG-3‘; for 18srRNA were: forward, 5’- TCGCTAGTTGGCATCGTTTATG -3‘ and reverse, 5‘-CGGAGGTTCGAAGACGATCA -3‘.