2.3 DNA extraction and PCR (Polymerase chain reaction) amplification
Microbial DNA was extracted using the HiPure Soil DNA Kits (or HiPure Stool DNA Kits) (Magen, Guangzhou, China). The 16S rDNA V3-V4 region of the ribosomal RNA gene was amplified for bacteria by PCR(95°C for 2min, followed by 27 cycles at 98°C for 10s, 62°C for the 30s, and 68°C for the 30s, and a final extension at 68°C for 10min using primers 341F: CCTACGGGNGGCWGCAG; 806R: GGACTACHVGGGTATCTAAT, and the ITS region of the Eukaryotic ribosomal RNA gene were amplified for fungi, using primers ITS3_KYO2F (5’- GATGAAGAACGYAGYRAA -3’) and ITS4R (5’TCCTCCGCTTATTGATATGC -3’), where the barcode is an eight-base sequence individual to each sample. PCR reactions were executed in a triplicate 50 μL mixture containing 5 μL of 10 × KOD Buffer, 5 μL of 2.5 mM dNTPs, 1.5 μL of each primer (5 μM), 1μL of KOD Polymerase, and 100ng of template DNA. Sequencing was performed using the Illumina HiSeq2500 (PE250) platform. Amplicons were extracted from 2% agarose gels and filtered using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) and quantified using ABI StepOnePlus Real-Time PCR System (Life Technologies, Foster City, USA). Purified amplicons were pooled in equimolar and paired-end sequenced (2 ×250) on an Illumina platform. The raw reads were deposited into the NCBI Sequence Read Archive (SRA) database.