Plasmid construction and plant transformation
To develop BnA09PHT5;1b /vpt1 andBnCnPHT5;1b /vpt1 transgenic plants and the ArabidopsisBnPHT5;1b overexpressing plants, the full-length coding sequence
of each BnPHT5;1b gene was amplified from ‘Westar 10’ then
inserted into the PMDC83-GFP vector at the EcoRI and XbaI restriction
sites driven by the CaMV35S promoter. To generate GUS reporter lines,
the 1,300 bp promoters of BnA09PHT5;1b and BnCnPHT5;1bwere amplified and introduced into the DX2181b-GUS plasmid using the
In-Fusion HD Cloning kit (Takara Bio). Transgenic Arabidopsis were
produced using the method of Clough and Bent (1998). To generateBnPHT5;1b double mutants, a pair of BnPHT5;1b target
sequences sgRNA1 (CGTGATACAGAGGAACAAGA) and sgRNA2
(TGTTCCTCTGTATCACGCAG) were designed using
CRISPR-P
(http://crispr.hzau.edu.cn/CRISPR2/). Then the pKSE401 vector (Xing et
al., 2014) was used to generate the Cas9-BnPHT5;1b construct,
which used the AtU6-26 and AtU6-29 promoters to drive two sgRNAs
expressions respectively. Transformation of B. napus was
performed using the hypocotyl of Westar 10 for Agrobacterium
infiltrating (De Block et al., 1989).