2.4 | DNA extraction and high-throughput sequencing analysis of intestinal microbiota
We sterilized the scalpels, tweezers, and scissors by heating at 180 °C for 2h before using them for DNA extraction. We also wiped the fish surface, the desktop and instruments used by using 75% alcohol to disinfect them. Afterwards, we collected the gut contents of the remaining four fish and placed them into sterile tubes under sterile conditions. The tubes containing the samples were immediately placed into liquid nitrogen and then stored at −80 °C until DNA extraction. The four intestine samples for herbivorous fishC. idellus were abbreviated as HE, filter feeder S. chuatsi as FI, omnivorous C. auratus as OM and carnivorous S. grahami as CA for convenient reporting. These samples were subjected to DNA extraction using the PowerFood Microbial DNA isolation kit (QIAGEN Srl, Milan, Italy) following manufacturer’s instructions. The quality and quantity of the DNA were checked by using gel electrophoresis and a Qubit 4 Fluorometer (Thermo Fisher Scientific, USA). Primers 341F: ACTCCTACGGGAGGCAGCAG and 806R: GGACTACHVGGGTATCTAAT were used to generate the PCR amplicons for the 16S rRNA gene V3 - V4 region on Illumina sequencing platform (HiSeq™ 2500, Beijing igeneCode Biotech Co., Ltd., Beijing, China).