Analysis of differential regulation of CsGGCT2;1transcript
For differential gene expression analysis, WT plants were germinated on
½ x MS media, and 2-week-old plants were transferred to ½ x Hoagland’s
solution. After acclimatization for 4-5 days, the hydroponic solution
was replaced with ½ x Hoagland’s solution containing 25 µM sodium
arsenite (AsIII). Plants were harvested at 0 (Control), 6, 12, 24, and
48 h of AsIII exposure. Finally, plants were flash-frozen in liquid
nitrogen and stored at -80oC until further analysis of
gene expression.
Total RNA was isolated from the roots and shoots of Camelina seedlings
using a Plant RNA isolation kit (Sigma-Aldrich Inc., St. Louis, MO)
following the manufacturer’s protocol. The cDNA was synthesized using
the Verso-cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA).CsGGCT2;1 forward (5’CTACAGCTACTGGACCATGTG 3’) and reverse (5’
TCACTTCCTCTGGCAAATCG 3’) and housekeeping gene CsEF1 forward (5’
CTGCTAACTTCACCTCCCAG 3’) and reverse (5’ GCTCCTTCTCAATCTCCTTACC 3’)
primers were used to perform qRT-PCR. The qRT-PCR amplification program
was 95°C for 5 min (1 cycle); 95°C for 15 seconds, 60°C for 45 seconds,
72°C for 1 min (32 cycles), and final extension at 72°C for 10 min (1
cycle). The relative expression level was analyzed by using the
delta-delta Ct (2–∆∆Ct) method (Livak and Schmittgen
2001).