Total nucleic acid extraction and detection ofM.pneumoniae
Total nucleic acids were extracted using a throat swab extraction kit (Health Gene Technologies, China) according to the manufacturer’s instruction.M. pneumonia was detected by SAT-MP kit (Shanghai Rendu Biotechnology Co, Ltd). Primers were targeted to 16s rRNA:MP-1(5’AATTTAATACGACTCACTATAGGGAGACACCGC
TCCACATGAAATTCCAAAACTCCC3’) and MP-2(5’CGGTAATACATAGGTCGCAAGC3’).The probe is FAM-5’CGGACUAUUAAUCUAGAGUGUGUCCG3’-DABCYL. The detection limit of this assay was 1000 DNA copies/ml regarding the respiratory specimens.