Generation of SVEP1-/- iPSC lines
An isogenic pair of SVEP1  GM23720 iPSC line was generated by CRISPR genome editing in collaboration with Horizon Discovery Ltd. A guide RNA targetting GAGACCGCGCCCGGGGCCCCCGGGAGTATCCCCGCGCCG CCCGCTCCTGGCGA, a region within exon 1 of Ensembl SVEP1 transcript SVEP1-003 (ENST00000374469.5) was designed. The underlined highlighted sequence indicates the protospacer adjacent motif and the italic sequence indicates the guide RNA. This guide RNA was co-transfected into iPSCs with a plasmid expressing CAS9. After transfection, iPSCs were serially diluted into 96 well plates to generate single cell clones. Single cell clones were genotyped by sequencing PCR products generated using primers CAGCCGCTCTGTCTCCAG and AGGAGATGGCAGGGATCTCT.