Materials and Methods
Animals. Generation of Plscr1 Knockout mice were generated using the clustered regularly interspaced short palindromic repeat (CRISPR)-associated Cas9 nuclease (CRISPR/Cas9) genome editing technique as previously described(Yang , 2013). Briefly, C57BL/6 female mice (7–8 weeks old) were superovulated by intraperitoneally injecting pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotrophin (hCG) and then mated to C57BL/6 male mice. The fertilized embryos (zygotes) were collected from the oviducts, and mixed Cas9 mRNA (50 ng/µl) and small guide RNA (sgRNA; 25 ng/µl) were injected into the cytoplasm of zygotes with visible pronuclei in Chatot-Ziomek-Bavister (CZB) medium. The injected zygotes were then cultured in Quinn’s Advantage cleavage medium (in vitro Fertilization, Inc.) for 24 h, at which time 18–20 2-cell–stage embryos were transferred into the oviduct of a pseudopregnant ICR female mouse at 0.5 day post coitus (dpc). The accession numbers of the Plscr1 cDNAs used to design sgRNA is NM_011636.2. To determine the nucleotide sequence of mutated alleles, genomic DNA of F0 mice was amplified using the following primers: forward, 5, -GGTGATCTCGATTCAGGGGT-3, , reverse, 5, - GGGGTTACTCGACCCTAAAA -3,. DNA sequencing was then performed after TA cloning into plasmid pMD19T. In order to obtain F1 knockout mice, F0 mice were crossed with C57BL/6 mice and newborns were examined by Sanger sequencing .All animal experiments were approved by the Shandong Academy of Agricultural Science and conducted accordingly. All methods were performed in accordance with the relevant guidelines and regulations.
Virus. SIV(QD-2018 strain) was a H1N1 strain that isolated and obtained from the diseased pigs in Shandong province of China, which can be used as one of representative strains for the analysis of variant strains. The virus was continuously passaged on MDCK cells and virus titer was as high as 104.5 TCID50/mL.
Cell culture, transfection. HEK 293T ,COS7 and A549 cells were maintained with 10% FBS DMEM medium at 37°C under 5% CO2, and transfected with expression vectors or siRNAs using Lipofectamine 2000 Transfection Reagent (thermofisher) according to the manufacturer’s instructions.
Plasmid construction. The cDNAs encoding the mouse Ildr1and Plscr1 were cloned into pmCherry-N1, pEGFP-C2, and pMyc-C2 (modified pEGFP-C2 with EGFP-coding sequence replaced by Myc-coding sequence) as we have reported. All the constructs were verified by Sanger sequencing.
Western blot. Cultured cells were transfected with expression vectors as described above or siRNAs synthesized by the Sigma-Aldrich company, then protein was resuspended with RIPA cell lysis containing 1 mM PMSF (Beyotime; Shanghai, China). After centrifuging at 4℃ for 20 min, the supernatant was analyzed by western blot. Protein samples were resolved by 10% SDS-PAGE, then transferred to a PVDF membrane. After blocking with 5% BSA buffer for 1 h, the membrane was incubated with Rabbit Polyclonal-PLSCR1 Polyclonal Antibody (Proteintech, Cat#11582-1-AP,1:1000 diluted), Rabbit Polyclonal-Anti-ILDR1 antibody (Abcam, Cat#ab89847,1:1000 diluted), Rabbit Polyclonal-Anti-H1N1 Influenza A virus Nucleocapsid protein antibody(Abcam,Cat#ab104870,1:1500 diluted), rabbit anti-GAPDH antibody(Abcam,Cat.#ab181602, 1:5000 diluted), rabbit anti-LaminB1 antibody(Abways,Cat.#AB0054, 1:3000 diluted) at 4℃ over night, followed by incubation with goat anti-mouse secondary antibody or goat anti-rabbit secondary (Cell Signaling Technology, Danvers, MA) at room tempreture for two hours. The signals were detected with the ECL system (Cell Signaling Technology, Danvers, MA).
RNA extraction, RT-PCR and Quantitative real-time PCR. Total RNA was isolated from virus-infected cells or mouse tissues and cDNA was carried out by reverse transcription (RT) following the kit instructions (TaKaRa Bio Inc., Dalian, China). The expression of gene or virus was analyzed by quantitative real-time PCR (SYBR® Premix Ex TaqTM system, Takara). The primers used were as follows: Ildr1 forward primer, CCGGCGGCTGATGAAGAAAGACTC, reverse primer, AGGGCAGCAACAGCGGGTAGGA;Plscr1 forward primer, GTGGGGCGTC TAGACCTTTC, reverse primer, CCAGGCATCACAGGTGAGTT; H1N1 forward primer, ACAGAAGTTATAAGAATGA, reverse primer, TGTCTCCGAAGAAAT AAGA;β-actin forward primer, ACGGCCAGGTCATCACTATTG, reverse primer, AGGGGCCGGACTCATCGTA. PCR reaction system and procedures were refered to Premix Taq kit instructions (Takara). PCR reaction sets were adjusted between 24 and 36 cycles , and annealing temperatures were adjusted between 55 and 60 °C. The PCR products were separated by electrophoresis on agarose gel.
Quantitative real-time PCR was carried out using SYBR® Premix Ex TaqTM system (Perfect Real Time, Takara). The primers and template were the same as that used in RT-PCR. Amplifiation and detection were run in a Roche 480 Sequence Detection System with an initial cycle of 95 °C for 10 s followed by 40 cycles of 95 °C for 5 s, 62 °C for 10 s and 72 °C for 5 s. All PCR reactions were performed in triplicate. Fold change in gene expression level was calculated using the 2-ΔΔctmethod and all PCR reactions were performed in triplicate.
Immunofluorescence assay. Infected cells or transfected cells with GFP- or mCherry-tagged proteins growing on Gelatin-coated glass cover slips were fixed with 4% paraformaldehyde (PFA) in PBS for 15 min and blocked with PBT1 buffer (0.1%Triton X-100, 1% BSA, 5% heat-inactivated goat serum in PBS, pH 7.3) for 30 min. Cells were incubated overnight at 4°C with corresponding diluted in PBT1 then washed twice with PBS for 10 min. And cells were incubated with FITC-conjugated secondary antibody diluted in PBT2 (0.1% Triton X-100, 0.1% BSA in PBS) for 1 h, followed by washing with PBS three times for 10 min. For nuclei staining, cells were incubated with DAPI (Solarbio Life Sciences) for 15 min, followed by three 10 min PBS washes, then mounted in 50% glycerol/PBS. The cells were imaged with an inverted fluorescence microscope(TE200, Nikon).
Immunohistochemistry. The tissues were fixed in 10% formalin solution, embedded in paraffin, sectioned to 4 μm thicknesses and dewaxed the paraffin sections to water. Then the sections were placed in a retrieval box filled with EDTA antigen retrieval buffer (PH8.0) in a microwave oven for antigen retrieval. After that, the sections were blocked with 5% BSA for 30 min at room temperature. The section were incubated with anti-PLSCR1antibody (1:50) overnight at 4°C. After a brief wash , the secondary antibody were used for detection at room temperature for 50 min and DAPI dye solution was added for 10 min in the dark . The images were taken using a light microscopy (Nikon Eclipse C1). For the controls, no antibody was added to the samples.
Cell fractionation. The PLSCR1-overexpressing or empty retrovirus-transduced control A549 cells grown in 6-well plates were infected with WSN virus at an MOI of 5. At 6 h p.i., the cells were separated into nuclear and cytoplasmic fractions by using Minute Nuclear and Cytoplasmic Extraction Reagents (SC-003, Invent) according to the manufacturer’s procedure. The amount of NP, ILDR1 and PLSCR1 in each fraction were determined by western blotting with a rabbit anti-NP pAb, a rabbit anti-ILDR1 pAb and a rabbit anti-PLSCR1 pAb, respectively. LaminB1 and GAPDH, nuclear and cytoplasmic fraction markers, respectively, were detected by western blotting with a rabbit anti-GAPDH pAb and a rabbit anti-LaminB1 pAb, respectively.
Co-immunoprecipitation (co-IP). HEK293T cells were transfected with expression vectors as described above, then washed twice with PBS 24 h after transfection and resuspended in ice-cold lysis buffer containing 150 mM NaCl, 50 mM Tris at pH 7.5, 0.1% Triton X-100, and 1×cocktail (Roche, Basel, Switzerland). After centrifuging at 4°C for 20 min, the supernatant was collected and incubated with immobilized anti-Myc or anti-EGFP antibody at 4°C overnight. Immunoprecipitated proteins were washed three times with 300 mM lysis buffer and then analyzed by western blot.
Statistical analyses. All data were expressed as means ± standard deviation (SD), and an independent-sample t -test was used to evaluate data using Graph Prism software. *p<0.05, **p<0.01, ***p<0.001.